2
I wanted to open a document and have it return to me the last number of a line containing '>' as reference. This of all lines that have this '>'.
or that he reads the amount of '>' that existed in the file and returned me in the form that I could put each number of this (1, 2, 3.) in a variable.
The dice appear that way:
'>'VE05.fasta.screen.Contig1 TTTTGTTTTTTTTTTTTTTTTTTTTATTTAATTTTTTTCTTTGGGGGGGG GGAAAATTTTTTTTTCCCTCCCTTCTACAACACAAGAAAAAAAAACTTCC '>'VE05.fasta.screen.Contig2 TTTTGTTTTTTTTTTTTTTTTTTTTATTTAATTTTTTTCTTTGGGGGGGG GGAAAATTTTTTTTTCCCTCCCTTCTACAACACAA
I made that code, but I know it’s incomplete.
open (my @number, '<', @n);
@number = chop ();
print "Contig's final number:@num";
close @n;